pgex hp53 1 393 addgene 2486 Search Results


pgex hp53 1 393 addgene 2486  (Addgene inc)
93
Addgene inc pgex hp53 1 393 addgene 2486
A Wing imaginal discs expressing the corresponding UAS transgenes under the sal> driver. When indicated the expression of the <t>hp53</t> was performed in a dronc mutant background. Imaginal discs were stained for GFP (green), DAPI (blue), Myc (white, only when indicated) and Dcp1 (red). A dotted green line marks the sal domain. Scale bar is 50 μm. B Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( A ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 by one-way ANOVA. C Wing imaginal discs expressing UAS- hp53 in different conditions of cell cycle arrest stained for GFP (green), DAPI (blue) and Dcp1 (red). D Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( C ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 and ** P value < 0.001 by one-way ANOVA. E Wing imaginal discs expressing the Dronc activity sensor under the sal> driver and the corresponding transgenes. The imaginal discs were stained for GFP (green), Myc (red) and DAPI (blue). A dotted red line marks the sal domain delimited by Myc staining. The scale bar is 50 μm. F Quantification of GFP (Dronc activity) in the sal domain of wing imaginal discs from the genotypes presented in ( E ). Error bars indicate SEM. The data are derived from three independent biological replicates, analyzing more than ten discs per genotype. **** P value < 0.0001 by one-way ANOVA. G Wing imaginal discs expressing UAS- hp53 ΔDBD with the sal > GFP driver in a wildtype, dronc and p53 mutant backgrounds stained for GFP (green), DAPI (blue) and Dcp1 (red). A dotted green line marks the sal domain. The scale bar is 50 μm. H Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( G ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 and *** P value < 0.005 by one-way ANOVA.
Pgex Hp53 1 393 Addgene 2486, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+hp53+1+393+addgene+2486/pmc13039399-366-44-47?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pgex hp53 1 393 addgene 2486 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


A Wing imaginal discs expressing the corresponding UAS transgenes under the sal> driver. When indicated the expression of the hp53 was performed in a dronc mutant background. Imaginal discs were stained for GFP (green), DAPI (blue), Myc (white, only when indicated) and Dcp1 (red). A dotted green line marks the sal domain. Scale bar is 50 μm. B Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( A ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 by one-way ANOVA. C Wing imaginal discs expressing UAS- hp53 in different conditions of cell cycle arrest stained for GFP (green), DAPI (blue) and Dcp1 (red). D Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( C ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 and ** P value < 0.001 by one-way ANOVA. E Wing imaginal discs expressing the Dronc activity sensor under the sal> driver and the corresponding transgenes. The imaginal discs were stained for GFP (green), Myc (red) and DAPI (blue). A dotted red line marks the sal domain delimited by Myc staining. The scale bar is 50 μm. F Quantification of GFP (Dronc activity) in the sal domain of wing imaginal discs from the genotypes presented in ( E ). Error bars indicate SEM. The data are derived from three independent biological replicates, analyzing more than ten discs per genotype. **** P value < 0.0001 by one-way ANOVA. G Wing imaginal discs expressing UAS- hp53 ΔDBD with the sal > GFP driver in a wildtype, dronc and p53 mutant backgrounds stained for GFP (green), DAPI (blue) and Dcp1 (red). A dotted green line marks the sal domain. The scale bar is 50 μm. H Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( G ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 and *** P value < 0.005 by one-way ANOVA.

Journal: Cell Death & Disease

Article Title: Transcription-dependent and -independent functions of Drosophila p53 isoforms in the induction of apoptosis and senescence-associated tumorigenesis

doi: 10.1038/s41419-026-08571-x

Figure Lengend Snippet: A Wing imaginal discs expressing the corresponding UAS transgenes under the sal> driver. When indicated the expression of the hp53 was performed in a dronc mutant background. Imaginal discs were stained for GFP (green), DAPI (blue), Myc (white, only when indicated) and Dcp1 (red). A dotted green line marks the sal domain. Scale bar is 50 μm. B Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( A ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 by one-way ANOVA. C Wing imaginal discs expressing UAS- hp53 in different conditions of cell cycle arrest stained for GFP (green), DAPI (blue) and Dcp1 (red). D Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( C ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 and ** P value < 0.001 by one-way ANOVA. E Wing imaginal discs expressing the Dronc activity sensor under the sal> driver and the corresponding transgenes. The imaginal discs were stained for GFP (green), Myc (red) and DAPI (blue). A dotted red line marks the sal domain delimited by Myc staining. The scale bar is 50 μm. F Quantification of GFP (Dronc activity) in the sal domain of wing imaginal discs from the genotypes presented in ( E ). Error bars indicate SEM. The data are derived from three independent biological replicates, analyzing more than ten discs per genotype. **** P value < 0.0001 by one-way ANOVA. G Wing imaginal discs expressing UAS- hp53 ΔDBD with the sal > GFP driver in a wildtype, dronc and p53 mutant backgrounds stained for GFP (green), DAPI (blue) and Dcp1 (red). A dotted green line marks the sal domain. The scale bar is 50 μm. H Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( G ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 and *** P value < 0.005 by one-way ANOVA.

Article Snippet: When ligated, the N and C-terminus of p53 maintain the ORF. p53-B-N-terminal forward: CAGTGAATTCATGAGTCTTCACAAGTCCGC (EcoR1) p53-B-N-terminal reverse: CAGTAGATCTCTAGCTTGGGCAGCGTGTTCGCC (BglII) p53-B-C-terminal forward: CAGTAGATCTATAGCAAGAAGCGCAAGTCCGTGCC (BglII) p53-B-C-terminal reverse: CAGTGAATTCTGGCAGCTCGTAGGCACGTTTC (EcoR1) UAS- hp53-6xMyc : The coding region of the full length human p53 was PCR amplified from the pGEX hp53 (1-393) Addgene 2486 with the following primers with EcoR1 flanking sites: hp53 Forward: CAGTGAATTCATGGAGGAGCCGCAGTCAG (EcoR1) hp53 Reverse: CAGTGAATTCGTCTGAGTCAGGCCCTTCTGTC (EcoR1) UAS- hp53 ΔDBD - 6xMyc : To delete the DBD (99–292aa) of hp53 we PCR amplified the N- and C- terminus of hp53 from the pGEX hp53 with the following primers and inserted a AvrII site for subsequent ligation between the two fragments and the pUAST-attB-6XMyc vector.

Techniques: Expressing, Mutagenesis, Staining, Derivative Assay, Activity Assay

A Wing imaginal discs expressing hp53 with the nub> driver. When indicated the expression of hp53 was combined with the UAS- miRHG or performed in a dronc mutant background. Imaginal discs were stained for GFP (green), DAPI (blue) and Dcp1 (white). A dotted green line marks the nub domain. The scale bar is 50 μm. B Quantification of the tumor overgrowths from the genotypes indicated in ( A ), calculated as a percentage of the nub domain. The data are derived from three independent biological replicates, analyzing more than ten discs per genotype. Error bars indicate SEM. **** P value < 0.0001 and not significant (ns) P value > 0.05 by one-way ANOVA. C , D Representative wildtype wing imaginal disc and disc expressing hp53 in a dronc mutant background ( n > 10) stained for GFP (green), DAPI (blue), MMP1 (red) and pH3 (white) in ( C ) or GFP (green), DAPI (blue) and EdU (white). A dotted green line marks the nub domain. Scale bar is 50 μm.

Journal: Cell Death & Disease

Article Title: Transcription-dependent and -independent functions of Drosophila p53 isoforms in the induction of apoptosis and senescence-associated tumorigenesis

doi: 10.1038/s41419-026-08571-x

Figure Lengend Snippet: A Wing imaginal discs expressing hp53 with the nub> driver. When indicated the expression of hp53 was combined with the UAS- miRHG or performed in a dronc mutant background. Imaginal discs were stained for GFP (green), DAPI (blue) and Dcp1 (white). A dotted green line marks the nub domain. The scale bar is 50 μm. B Quantification of the tumor overgrowths from the genotypes indicated in ( A ), calculated as a percentage of the nub domain. The data are derived from three independent biological replicates, analyzing more than ten discs per genotype. Error bars indicate SEM. **** P value < 0.0001 and not significant (ns) P value > 0.05 by one-way ANOVA. C , D Representative wildtype wing imaginal disc and disc expressing hp53 in a dronc mutant background ( n > 10) stained for GFP (green), DAPI (blue), MMP1 (red) and pH3 (white) in ( C ) or GFP (green), DAPI (blue) and EdU (white). A dotted green line marks the nub domain. Scale bar is 50 μm.

Article Snippet: When ligated, the N and C-terminus of p53 maintain the ORF. p53-B-N-terminal forward: CAGTGAATTCATGAGTCTTCACAAGTCCGC (EcoR1) p53-B-N-terminal reverse: CAGTAGATCTCTAGCTTGGGCAGCGTGTTCGCC (BglII) p53-B-C-terminal forward: CAGTAGATCTATAGCAAGAAGCGCAAGTCCGTGCC (BglII) p53-B-C-terminal reverse: CAGTGAATTCTGGCAGCTCGTAGGCACGTTTC (EcoR1) UAS- hp53-6xMyc : The coding region of the full length human p53 was PCR amplified from the pGEX hp53 (1-393) Addgene 2486 with the following primers with EcoR1 flanking sites: hp53 Forward: CAGTGAATTCATGGAGGAGCCGCAGTCAG (EcoR1) hp53 Reverse: CAGTGAATTCGTCTGAGTCAGGCCCTTCTGTC (EcoR1) UAS- hp53 ΔDBD - 6xMyc : To delete the DBD (99–292aa) of hp53 we PCR amplified the N- and C- terminus of hp53 from the pGEX hp53 with the following primers and inserted a AvrII site for subsequent ligation between the two fragments and the pUAST-attB-6XMyc vector.

Techniques: Expressing, Mutagenesis, Staining, Derivative Assay